1. {{Autism testing service includes telephone counseling: Bypasses initial genetics exam}}. {Am J Med Genet A};2012 (Apr);158A(4):viii-ix.
Lien vers le texte intégral (Open Access ou abonnement)
2. Addington AM, Gauthier J, Piton A, Hamdan FF, Raymond A, Gogtay N, Miller R, Tossell J, Bakalar J, Germain G, Gochman P, Long R, Rapoport JL, Rouleau GA. {{A novel frameshift mutation in UPF3B identified in brothers affected with childhood onset schizophrenia and autism spectrum disorders}}. {Mol Psychiatry};2012 (Apr);17(4):468.
Lien vers le texte intégral (Open Access ou abonnement)
3. Ali SI, Byrne N, Mulligan A. {{Autism in association with Triple X syndrome}}. {Eur Child Adolesc Psychiatry};2012 (Apr);21(4):233-235.
Lien vers le texte intégral (Open Access ou abonnement)
4. Armani R, Archer H, Clarke A, Vasudevan P, Zweier C, Ho G, Williamson S, Cloosterman D, Yang N, Christodoulou J. {{Transcription Factor 4 and Myocyte Enhancer Factor 2C mutations are not common causes of Rett syndrome}}. {Am J Med Genet A};2012 (Apr);158A(4):713-719.
The systematic screening of Rett syndrome (RTT) patients for pathogenetic sequence variations has focused on three genes that have been associated with RTT or related clinical phenotypes, namely MECP2, CDKL5, and FOXG1. More recently, it has been suggested that phenotypes associated with TCF4 and MEF2C mutations may represent a form of RTT. Here we report on the screening of the TCF4 and MEF2C genes in a cohort of 81 classical, atypical, and incomplete atypical RTT patients harboring no known mutations in MECP2, CDKL5, and FOXG1 genes. No pathogenetic sequence variations were identified in the MEF2C gene in our cohort. However, a frameshift mutation in TCF4 was identified in a patient with a clinical diagnosis of « variant » RTT, in whom the clinical evolution later raised the possibility of Pitt-Hopkins syndrome. Although our results suggest that these genes are not commonly associated with RTT, we note the clinical similarity between RTT and Pitt-Hopkins syndrome, and suggest that RTT patients with no mutation identified in MECP2 be considered for molecular screening of the TCF4 gene. (c) 2012 Wiley Periodicals, Inc.
Lien vers le texte intégral (Open Access ou abonnement)
5. Auert EJ, Trembath D, Arciuli J, Thomas D. {{Parents’ expectations, awareness, and experiences of accessing evidence-based speech-language pathology services for their children with autism}}. {Int J Speech Lang Pathol};2012 (Apr);14(2):109-118.
Abstract The aim of this study was to explore the expectations, awareness, and experiences of parents in their efforts to access evidence-based speech-language pathology (SLP) services for their children with autism spectrum disorders (ASD). Four focus groups were conducted with 20 parents of pre school aged children with ASD and transcripts were analysed using thematic analysis. Two themes emerged to account for the participants’ expectations, awareness, and experiences. The two themes, « Speech-language pathology: More than just a business », and « Parents and power », represented the complex interaction between factors including the parents’ access to information, their involvement in the therapy process, and their sense of empowerment. The parents in this study expressed a strong desire for evidence-based practice (EBP) to be employed. However, the parents had different views on how EBP should be achieved. The findings of this study demonstrate the importance of involving parents in therapeutic relationships as partners in the decision-making process. This means providing parents with comprehensive information, including research evidence to support the clinical decisions that need to be made, and respecting parents’ preferences in the therapy process.
Lien vers le texte intégral (Open Access ou abonnement)
6. Bergstrom R, Najdowski AC, Tarbox J. {{Teaching children with autism to seek help when lost in public}}. {J Appl Behav Anal};2012 (Spring);45(1):191-195.
Children with autism may not develop safety skills (e.g., help-seeking behaviors) without explicit teaching. One potentially hazardous situation is when a child with autism becomes separated from caregivers in a retail establishment or other public setting. The purpose of this study was to evaluate a treatment package (rules, role playing, and praise) delivered in the natural environment for teaching 3 boys with autism to seek assistance from store employees when they became lost. Treatment was effective, and help-seeking behaviors generalized to untrained stores for all participants.
Lien vers le texte intégral (Open Access ou abonnement)
7. Bou Khalil R. {{Would some cannabinoids ameliorate symptoms of autism?}}. {Eur Child Adolesc Psychiatry};2012 (Apr);21(4):237-238.
Lien vers le texte intégral (Open Access ou abonnement)
8. Caffarelli C, Gonnelli S, Tanzilli L, Hayek J, Vichi V, Franci MB, Lucani B, Nuti R. {{The relationship between serum ghrelin and body composition with bone mineral density and QUS parameters in subjects with Rett syndrome}}. {Bone};2012 (Apr);50(4):830-835.
Several studies have reported that females with Rett’s syndrome frequently have marked decreases in bone mineral density (BMD). However, the pathogenesis of impaired bone status in RTT girls remains controversial. This study aimed to investigate whether ghrelin, an orexigenic peptide secreted by the stomach, was associated with body composition parameters, bone mineral density and quantitative ultrasound (QUS) in girls with Rett’s syndrome. In 123 Rett girls (13.6+/-8.2years) and in 55 similar age range controls we evaluated ghrelin serum levels, 25OHD, quantitative ultrasound parameters at phalanxes by Bone Profiler-IGEA (amplitude dependent speed of sound: AD-SoS and bone transmission time: BTT), total body bone mineral density (BMD-WB) by Hologic QDR 4500. Whole body mineral content (BMC-WB), BMC-WB/height, fat mass (FM), fat percentage and lean mass (LM) were determined by using the same DXA device. We found that serum ghrelin levels were significantly higher in the Rett patients with respect to the control group (p<0.05). In Rett girls ghrelin serum levels were inversely correlated with both age (R(2)=0.17, p<0.001) and BMI (R(2)=0.14, p<0.001). Moreover, in Rett subjects the values of BMD-WB, BMC-WB, BMC-WB/height and QUS parameters were significantly lower than in control subjects. Fat mass and lean mass were lower in Rett subjects than in controls, but the difference reached the statistical significance only for lean mass. In Rett girls ghrelin serum levels were not predictors of bone status. Instead, we found that in Rett subjects, lean mass, age and 25OHD were significant independent predictors of BMC-WB/h, whereas both age and height were independent predictors of BMD-WB. Moreover, AD-SoS was predicted by age, fat percentage and height; while BTT was predicted only by height. In conclusion, our findings indicate that ghrelin levels were higher in Rett girls with respect to healthy controls, and negatively associated with both DXA and QUS parameters. However, in our study ghrelin was not found to be an independent predictor of bone mass, so supporting the hypothesis that ghrelin is elevated in Rett subjects in a compensatory manner.
Lien vers le texte intégral (Open Access ou abonnement)
9. Carmody DP, Lewis M. {{Self representation in children with and without autism spectrum disorders}}. {Child Psychiatry Hum Dev};2012 (Apr);43(2):227-237.
In order to examine the roles of mental age, social interaction, and communication in self-representation abilities, typically-developing children were compared with children with Autism Spectrum Disorders. Typically-developing children (TD, n = 66) and children with Autism Spectrum Disorders (ASD, n = 20), including subgroups of autistic disorder and pervasive developmental disorder-not otherwise specified, were assessed on self-representation ability, which was measured by mirror recognition, other-directed pretend play, and use of personal pronouns. More TD children (100%) showed mirror recognition than ASD children (55%). TD children were more likely to show other-directed pretense (80%) than the ASD group (35%). Personal pronouns were used more by TD children (83%) than by ASD children (63%). Self-representation ability appears to be underdeveloped in some children with ASD. Self-representation ability in children with ASD was related to the Social Interaction subscale of the Autism Diagnostic Observation Schedule such that greater self representation ability was associated with better Social Interaction scores, although it was not related to the Communication scores of the ADOS-G. The mental age of the children with ASD was at least 2 years; therefore, the deficits in self representation in children with ASD cannot be explained by mental age alone.
Lien vers le texte intégral (Open Access ou abonnement)
10. Casey JP, Magalhaes T, Conroy JM, Regan R, Shah N, Anney R, Shields DC, Abrahams BS, Almeida J, Bacchelli E, Bailey AJ, Baird G, Battaglia A, Berney T, Bolshakova N, Bolton PF, Bourgeron T, Brennan S, Cali P, Correia C, Corsello C, Coutanche M, Dawson G, de Jonge M, Delorme R, Duketis E, Duque F, Estes A, Farrar P, Fernandez BA, Folstein SE, Foley S, Fombonne E, Freitag CM, Gilbert J, Gillberg C, Glessner JT, Green J, Guter SJ, Hakonarson H, Holt R, Hughes G, Hus V, Igliozzi R, Kim C, Klauck SM, Kolevzon A, Lamb JA, Leboyer M, Le Couteur A, Leventhal BL, Lord C, Lund SC, Maestrini E, Mantoulan C, Marshall CR, McConachie H, McDougle CJ, McGrath J, McMahon WM, Merikangas A, Miller J, Minopoli F, Mirza GK, Munson J, Nelson SF, Nygren G, Oliveira G, Pagnamenta AT, Papanikolaou K, Parr JR, Parrini B, Pickles A, Pinto D, Piven J, Posey DJ, Poustka A, Poustka F, Ragoussis J, Roge B, Rutter ML, Sequeira AF, Soorya L, Sousa I, Sykes N, Stoppioni V, Tancredi R, Tauber M, Thompson AP, Thomson S, Tsiantis J, Van Engeland H, Vincent JB, Volkmar F, Vorstman JA, Wallace S, Wang K, Wassink TH, White K, Wing K, Wittemeyer K, Yaspan BL, Zwaigenbaum L, Betancur C, Buxbaum JD, Cantor RM, Cook EH, Coon H, Cuccaro ML, Geschwind DH, Haines JL, Hallmayer J, Monaco AP, Nurnberger JI, Jr., Pericak-Vance MA, Schellenberg GD, Scherer SW, Sutcliffe JS, Szatmari P, Vieland VJ, Wijsman EM, Green A, Gill M, Gallagher L, Vicente A, Ennis S. {{A novel approach of homozygous haplotype sharing identifies candidate genes in autism spectrum disorder}}. {Hum Genet};2012 (Apr);131(4):565-579.
Autism spectrum disorder (ASD) is a highly heritable disorder of complex and heterogeneous aetiology. It is primarily characterized by altered cognitive ability including impaired language and communication skills and fundamental deficits in social reciprocity. Despite some notable successes in neuropsychiatric genetics, overall, the high heritability of ASD (~90%) remains poorly explained by common genetic risk variants. However, recent studies suggest that rare genomic variation, in particular copy number variation, may account for a significant proportion of the genetic basis of ASD. We present a large scale analysis to identify candidate genes which may contain low-frequency recessive variation contributing to ASD while taking into account the potential contribution of population differences to the genetic heterogeneity of ASD. Our strategy, homozygous haplotype (HH) mapping, aims to detect homozygous segments of identical haplotype structure that are shared at a higher frequency amongst ASD patients compared to parental controls. The analysis was performed on 1,402 Autism Genome Project trios genotyped for 1 million single nucleotide polymorphisms (SNPs). We identified 25 known and 1,218 novel ASD candidate genes in the discovery analysis including CADM2, ABHD14A, CHRFAM7A, GRIK2, GRM3, EPHA3, FGF10, KCND2, PDZK1, IMMP2L and FOXP2. Furthermore, 10 of the previously reported ASD genes and 300 of the novel candidates identified in the discovery analysis were replicated in an independent sample of 1,182 trios. Our results demonstrate that regions of HH are significantly enriched for previously reported ASD candidate genes and the observed association is independent of gene size (odds ratio 2.10). Our findings highlight the applicability of HH mapping in complex disorders such as ASD and offer an alternative approach to the analysis of genome-wide association data.
Lien vers le texte intégral (Open Access ou abonnement)
11. Chen Y, Norton DJ, McBain R, Gold J, Frazier JA, Coyle JT. {{Enhanced local processing of dynamic visual information in autism: Evidence from speed discrimination}}. {Neuropsychologia};2012 (Apr);50(5):733-739.
An important issue for understanding visual perception in autism concerns whether individuals with this neurodevelopmental disorder possess an advantage in processing local visual information, and if so, what is the nature of this advantage. Perception of movement speed is a visual process that relies on computation of local spatiotemporal signals but requires the comparison of information from more than a single spatial location or temporal point. This study examined speed discrimination in adolescents (ages 13-18 years old) with autism spectrum disorders (ASD). Compared to healthy controls (n=17), individuals with ASD (n=19) showed similarly precise speed discrimination when two comparison motion stimuli (random dot patterns) were presented closely in time (0.5s). With a longer temporal interval (3s) between the motion stimuli, individuals with ASD outperformed healthy controls on speed discrimination. On a second task-global motion perception-in which individuals were asked to detect coherent motion, individuals with ASD exhibited slightly degraded performance levels. The observed temporally selective enhancement in speed discrimination indicates that a local processing advantage in autism develops over a longer temporal range and is not limited to the spatial domain. These results suggest a dynamic perceptual mechanism for understanding, and therapeutically addressing, atypical visual processing in this neurodevelopmental disorder.
Lien vers le texte intégral (Open Access ou abonnement)
12. Chevallier C, Kohls G, Troiani V, Brodkin ES, Schultz RT. {{The social motivation theory of autism}}. {Trends Cogn Sci};2012 (Apr);16(4):231-239.
The idea that social motivation deficits play a central role in Autism Spectrum Disorders (ASD) has recently gained increased interest. This constitutes a shift in autism research, which has traditionally focused more intensely on cognitive impairments, such as theory-of-mind deficits or executive dysfunction, and has granted comparatively less attention to motivational factors. This review delineates the concept of social motivation and capitalizes on recent findings in several research areas to provide an integrated account of social motivation at the behavioral, biological and evolutionary levels. We conclude that ASD can be construed as an extreme case of diminished social motivation and, as such, provides a powerful model to understand humans’ intrinsic drive to seek acceptance and avoid rejection.
Lien vers le texte intégral (Open Access ou abonnement)
13. Choi J, Ababon MR, Matteson PG, Millonig JH. {{Cut-like homeobox 1 and nuclear factor I/B mediate ENGRAILED2 autism spectrum disorder-associated haplotype function}}. {Hum Mol Genet};2012 (Apr 1);21(7):1566-1580.
Both common and rare variants contribute to autism spectrum disorder (ASD) risk, but few variants have been established as functional. Previously we demonstrated that an intronic haplotype (rs1861972-rs1861973 A-C) in the homeobox transcription factor ENGRAILED2 (EN2) is significantly associated with ASD. Positive association has also been reported in six additional data sets, suggesting EN2 is an ASD susceptibility gene. Additional support for this possibility requires identification of functional variants that affect EN2 regulation or activity. In this study, we demonstrate that the A-C haplotype is a transcriptional activator. Luciferase (luc) assays in mouse neuronal cultures determined that the A-C haplotype increases expression levels (50%, P < 0.01, 24 h; 250%, P < 0.0001, 72 h). Mutational analysis indicates that the A-C haplotype activator function requires both associated A and C alleles. A minimal 202-bp element is sufficient for function and also specifically binds a protein complex. Mass spectrometry identified these proteins as the transcription factors, Cut-like homeobox 1 (Cux1) and nuclear factor I/B (Nfib). Subsequent antibody supershifts and chromatin immunoprecipitations demonstrated that human CUX1 and NFIB bind the A-C haplotype. Co-transfection and knock-down experiments determined that both CUX1 and NFIB are required for the A-C haplotype activator function. These data demonstrate that the ASD-associated A-C haplotype is a transcriptional activator, and both CUX1 and NFIB mediate this activity. These results provide biochemical evidence that the ASD-associated A-C haplotype is functional, further supporting EN2 as an ASD susceptibility gene.
Lien vers le texte intégral (Open Access ou abonnement)
14. Chonchaiya W, Au J, Schneider A, Hessl D, Harris SW, Laird M, Mu Y, Tassone F, Nguyen DV, Hagerman RJ. {{Increased prevalence of seizures in boys who were probands with the FMR1 premutation and co-morbid autism spectrum disorder}}. {Hum Genet};2012 (Apr);131(4):581-589.
Seizures are a common co-occurring condition in those with fragile X syndrome (FXS), and in those with idiopathic autism spectrum disorder (ASD). Seizures are also associated with ASD in those with FXS. However, little is known about the rate of seizures and how commonly these problems co-occur with ASD in boys with the FMR1 premutation. We, therefore, determined the prevalence of seizures and ASD in boys with the FMR1 premutation compared with their sibling counterparts and population prevalence estimates. Fifty premutation boys who presented as clinical probands (N = 25), or non-probands (identified by cascade testing after the proband was found) (N = 25), and 32 non-carrier controls were enrolled. History of seizures was documented and ASD was diagnosed by standardized measures followed by a team consensus of ASD diagnosis. Seizures (28%) and ASD (68%) were more prevalent in probands compared with non-probands (0 and 28%), controls (0 and 0%), and population estimates (1 and 1.7%). Seizures occurred more frequently in those with the premutation and co-morbid ASD particularly in probands compared with those with the premutation alone (25 vs. 3.85%, p = 0.045). Although cognitive and adaptive functioning in non-probands were similar to controls, non-probands were more likely to meet the diagnosis of ASD than controls (28 vs. 0%, p < 0.0001). In conclusion, seizures were relatively more common in premutation carriers who presented clinically as probands of the family and seizures were commonly associated with ASD in these boys. Therefore, boys with the premutation, particularly if they are probands should be assessed carefully for both ASD and seizures.
Lien vers le texte intégral (Open Access ou abonnement)
15. Chung BH, Mullegama S, Marshall CR, Lionel AC, Weksberg R, Dupuis L, Brick L, Li C, Scherer SW, Aradhya S, Stavropoulos DJ, Elsea SH, Mendoza-Londono R. {{Severe intellectual disability and autistic features associated with microduplication 2q23.1}}. {Eur J Hum Genet};2012 (Apr);20(4):398-403.
We report on two patients with developmental delay, hypotonia, and autistic features associated with duplications of chromosome region 2q23.1-2q23.2 detected by chromosome microarray analysis. The duplications include one OMIM Morbid Map gene, MBD5, as well as seven known RefSeq genes (ACVR2A, ORC4L, EPC2, KIF5C, MIR1978, LYPD6B, and LYPD6). MBD5 lies in the minimum area of overlap of the 2q23.1 microdeletion syndrome. This report provides the first detailed clinical examination of two individuals with a duplication of this region and suggests that brain development and cognitive function may be affected by an increased dosage of the genes involved.
Lien vers le texte intégral (Open Access ou abonnement)
16. Ciccoli L, De Felice C, Paccagnini E, Leoncini S, Pecorelli A, Signorini C, Belmonte G, Valacchi G, Rossi M, Hayek J. {{Morphological changes and oxidative damage in Rett Syndrome erythrocytes}}. {Biochim Biophys Acta};2012 (Apr);1820(4):511-520.
BACKGROUND: Hypoxemia and increased oxidative stress (OS) have been reported in Rett Syndrome (RTT), a genetical neurodevelopmental disorder. Although OS and hypoxemia can lead to red blood cells (RBCs) shape abnormalities, no information on RBCs morphology in RTT exists. Here, RBCs shape was evaluated in RTT patients and healthy subjects as a function of OS markers, blood oxygenation, pulmonary gas exchange, and cardio-respiratory parameters. METHODS: RBCs morphology was evaluated by Scanning Electron Microscopy. Intraerythrocyte and plasma non protein-bound iron (NPBI), esterified F(2)-Isoprostanes (F(2)-IsoPs), 4-HNE protein adducts (4-HNE PAs) were measured. Pulmonary oxygen gradients and PaO(2) were evaluated by gas analyzers and cardiopulmonary variables by pulse oximetry. In RTT patients these parameters were assessed before and after omega-3 polyunsaturated fatty acids (omega-3 PUFAs) administration. RESULTS: Altered RBCs shapes (leptocytes) and increased NPBI were present in RTT, together with increased erythrocyte membrane esterified F(2)-IsoPs and 4-HNE PAs. Abnormal erythrocyte shapes were related to OS markers levels, pulmonary gas exchange, PaO(2) and cardio-respiratory variables. After omega-3 PUFAs, a decrease of leptocytes was accompanied by a progressive increase in reversible forms of RBCs. This partial RBCs morphology rescue was related to decreased OS damage markers, improved pulmonary oxygen exchange, and cardiopulmonary physiology. CONCLUSIONS: These findings indicate that in RTT 1) RBCs shape is altered; 2) the OS-hypoxia diad is critical in generating altered RBCs shape and membrane damage; 3) omega-3 PUFAs are able to partially rescue RBCs morphology and the OS-derived damage. GENERAL SIGNIFICANCE: RBCs morphology is an important biosensor for OS imbalance and chronic hypoxemia.
Lien vers le texte intégral (Open Access ou abonnement)
17. Corbani S, Chouery E, Fayyad J, Fawaz A, El Tourjuman O, Badens C, Lacoste C, Delague V, Megarbane A. {{Molecular screening of MECP2 gene in a cohort of Lebanese patients suspected with Rett syndrome: report on a mild case with a novel indel mutation}}. {J Intellect Disabil Res};2012 (Apr);56(4):415-420.
Background Rett syndrome (RTT), an X-linked, dominant, neurodevelopment disorder represents 10% of female subjects with profound intellectual disability. Mutations in the MECP2 gene are responsible for up to 95% of the classical RTT cases, and nearly 500 different mutations distributed throughout the gene have been reported. Methods We report here the molecular study of two isoforms, MECP2_e1 and MECP2_e2, in 45 Lebanese girls presenting developmental delay and at least one of the following features: microcephaly, neurodegeneration, abnormal behaviour, stereotypical hand movements, teeth grinding and difficulty in walking. Mutation screening was performed by denaturating high-performance liquid chromatography combined with direct sequencing. Results Sixteen variants were noted, of which 14 have been previously reported: five suspected polymorphisms and nine mutations. Two variants were novel mutations in exon 4: c.1093_1095delGAG (p.E365del) and c.1164_1184delACCTCCACCTGAGCCCGAGAGinsCTGAGCCCCAGGACTTGAGCA (p.P388PfsX389). The deletion was found in an 8-year-old girl with typical clinical features of RTT. The indel was found in a 6-year-old girl with a very mild phenotype. Conclusion Genotype/phenotype correlation is discussed and the importance of a molecular study of MECP2 gene in patients with very mild features or a regression after the age of 2 is raised.
Lien vers le texte intégral (Open Access ou abonnement)
18. Cortese S, Castelnau P, Morcillo C, Roux S, Bonnet-Brilhault F. {{Psychostimulants for ADHD-like symptoms in individuals with autism spectrum disorders}}. {Expert Rev Neurother};2012 (Apr);12(4):461-473.
We conducted a comprehensive review of studies assessing the efficacy and tolerability of psychostimulants for ADHD-like symptoms in individuals with autism spectrum disorder (encompassing autism disorder, Asperger’s syndrome and pervasive developmental disorders not otherwise specified). PubMed, Ovid, EMBASE, Web of Science, ERIC and CINHAL were searched through 3 January 2012. From a pool of 348 potentially relevant references, 12 citations (11 studies) were retained as pertinent. Four of the included studies had a randomized controlled design. Most of the studies assessed methylphenidate immediate release. Despite inter-study heterogeneity, taken together, the results of the selected reports suggest that psychostimulants may be effective for ADHD-like symptoms in autism spectrum disorder individuals. The most common adverse events reported in the included trials were appetite reduction, sleep-onset difficulties, irritability and emotional outbursts. We discuss future directions in the field, including the need for trials assessing more ecological outcomes and combined treatment strategies tailored to the specific individual features.
Lien vers le texte intégral (Open Access ou abonnement)
19. Cunningham AB. {{Measuring change in social interaction skills of young children with autism}}. {J Autism Dev Disord};2012 (Apr);42(4):593-605.
Designing effective treatments for improving early social behaviors in autism has been identified as a critical research need. One barrier to drawing conclusions about optimal treatments for children with autism is the use of highly varied dependent measures in the treatment literature. Contributing to this is the absence of « gold standard » assessment batteries. This is particularly true for assessing changes in social interaction impairments in very young children with autism. This paper addresses this issue by reviewing variables important in the development and evaluation of assessment measures, discussing previous studies’ choices of socially-related dependent measures, and the strengths, limitations, and research questions pertaining to them. It concludes with recommendations for measurement selection and future directions for research.
Lien vers le texte intégral (Open Access ou abonnement)
20. Dager SR, Corrigan NM, Estes A, Shaw DW. {{Further commentary on mitochondrial dysfunction in autism spectrum disorder: assessment and treatment considerations}}. {J Autism Dev Disord};2012 (Apr);42(4):643-646.
The authors respond to a recent letter (Rossignol and Frye 2011) critical of their paper, « Proton magnetic resonance spectroscopy and MRI reveal no evidence for brain mitochondrial dysfunction in children with autism spectrum disorder » (Corrigan et al. 2011). Further considerations regarding the assessment of mitochondrial dysfunction in autism spectrum disorder, and related treatment considerations, are discussed.
Lien vers le texte intégral (Open Access ou abonnement)
21. Danesh AA, Kaf WA. {{DPOAEs and contralateral acoustic stimulation and their link to sound hypersensitivity in children with autism}}. {Int J Audiol};2012 (Apr);51(4):345-352.
Abstract Objective: The hypersensitivity of children with autism to sound is a relatively unexplained behavior. The goal of the current study was to investigate the DPOAE characteristics of children with autism compared to a control group. Design: DPOAEs with and without contralateral stimuli were measured in two groups in three different conditions. Study sample: The study employed 14 children with autism and a control group with 28 age-matched participants. Results: In the without-contralateral stimulus condition, the overall S/N of DPOAEs was greater for the control group compared to the autism group (p < 0.0005). For both groups, the DPOAE S/N increased as a function of frequency in both ears. In the with contralateral stimulus condition, group and ear effects were noticed, however, no age, frequency, or contralateral stimulus type (BBN vs. 1000 Hz) effect could be detected. Conclusions: Presence of reduced DPOAEs in the autism group does not support the hypothesis that sound hypersensitivity in children with autism may be related to overactive outer hair cells function; rather it may be due to early cochlear dysfunction. Also, sound hypersensitivity in the autism group may be due to abnormality of the efferent auditory pathway as shown by lack of sufficient contralateral suppression.
Lien vers le texte intégral (Open Access ou abonnement)
22. De Filippis B, Fabbri A, Simone D, Canese R, Ricceri L, Malchiodi-Albedi F, Laviola G, Fiorentini C. {{Modulation of RhoGTPases Improves the Behavioral Phenotype and Reverses Astrocytic Deficits in a Mouse Model of Rett Syndrome}}. {Neuropsychopharmacology};2012 (Apr);37(5):1152-1163.
RhoGTPases are crucial molecules in neuronal plasticity and cognition, as confirmed by their role in non-syndromic mental retardation. Activation of brain RhoGTPases by the bacterial cytotoxic necrotizing factor 1 (CNF1) reshapes the actin cytoskeleton and enhances neurotransmission and synaptic plasticity in mouse brains. We evaluated the effects of a single CNF1 intracerebroventricular inoculation in a mouse model of Rett syndrome (RTT), a rare neurodevelopmental disorder and a genetic cause of mental retardation, for which no effective therapy is available. Fully symptomatic MeCP2-308 male mice were evaluated in a battery of tests specifically tailored to detect RTT-related impairments. At the end of behavioral testing, brain sections were immunohistochemically characterized. Magnetic resonance imaging and spectroscopy (MRS) were also applied to assess morphological and metabolic brain changes. The CNF1 administration markedly improved the behavioral phenotype of MeCP2-308 mice. CNF1 also dramatically reversed the evident signs of atrophy in astrocytes of mutant mice and restored wt-like levels of this cell population. A partial rescue of the overexpression of IL-6 cytokine was also observed in RTT brains. CNF1-induced brain metabolic changes detected by MRS analysis involved markers of glial integrity and bioenergetics, and point to improved mitochondria functionality in CNF1-treated mice. These results clearly indicate that modulation of brain RhoGTPases by CNF1 may constitute a totally innovative therapeutic approach for RTT and, possibly, for other disorders associated with mental retardation.
Lien vers le texte intégral (Open Access ou abonnement)
23. Doherty-Sneddon G, Riby DM, Whittle L. {{Gaze aversion as a cognitive load management strategy in autism spectrum disorder and Williams syndrome}}. {J Child Psychol Psychiatry};2012 (Apr);53(4):420-430.
BACKGROUND: During face-to-face questioning, typically developing children and adults use gaze aversion (GA), away from their questioner, when thinking. GA increases with question difficulty and improves the accuracy of responses. This is the first study to investigate whether individuals with autism spectrum disorder (ASD; associated with reduced sociability and atypical face gaze) and Williams syndrome (WS; associated with hypersociability and atypical face gaze) use GA to manage cognitive load during face-to-face interactions. METHODS: Two studies were conducted exploring the typicality of GA during face-to-face questioning in (a) ASD and (b) WS. RESULTS: In Study 1, children with ASD increased their GA as question difficulty increased. In addition, they used most GA when thinking about their responses to questions, mirroring evidence from typically developing children. An important atypicality for participants with ASD was a significantly higher level of GA when listening to interlocutors. In Study 2, participants with WS showed typical patterns of GA in relation to question difficulty and across different points of the interaction. CONCLUSIONS: Two different neuro-developmental disorders, both characterized by significant problems with executive control of attention and atypicalities of social interactions, exhibited generally typical patterns of GA. All groups used most GA while thinking about questions, and increased their GA as questions got harder. In addition, children with ASD showed elevated levels of GA while listening to questions, but not while thinking about or making their responses, suggesting that they sometimes fail to see the relevance of attending to visual cues rather than actively avoiding them. Results have important implications for how professionals interpret GA in these populations and for social skills training.
Lien vers le texte intégral (Open Access ou abonnement)
24. Downey R, Rapport MJ. {{Motor activity in children with autism: a review of current literature}}. {Pediatr Phys Ther};2012 (Spring);24(1):2-20.
Physical therapists have expanded their role and visibility in the treatment of children with autism spectrum disorders (ASD). Limitations in motor activity have not been considered in the assessments of core deficits of this population; however, physical therapists should be prepared to discuss and address these limitations in children with ASD. PURPOSE: The primary purposes of this review were to summarize current evidence for motor activity limitations in children with ASD and suggest further areas of research in physical therapy and autism while considering how physical therapy may benefit children with autism. METHOD: A literature search was carried out in 2009 and 2010 by using multiple search engines. RESULTS: Forty-nine articles met inclusion criteria and were included in the review. CONCLUSION: Findings indicate that limitations in motor activity may be present in individuals with ASD, and further research is needed to identify specific functional limitations.
Lien vers le texte intégral (Open Access ou abonnement)
25. Freedman BH, Kalb LG, Zablotsky B, Stuart EA. {{Relationship status among parents of children with autism spectrum disorders: a population-based study}}. {J Autism Dev Disord};2012 (Apr);42(4):539-548.
Despite speculation about an 80% divorce rate among parents of children with an Autism Spectrum Disorder (ASD), very little empirical and no epidemiological research has addressed the issue of separation and divorce among this population. Data for this study was taken from the 2007 National Survey of Children’s Health, a population-based, cross-sectional survey. A total of 77,911 parent interviews were completed on children aged 3-17 years, of which 913 reported an ASD diagnosis. After controlling for relevant covariates, results from multivariate analyses revealed no evidence to suggest that children with ASD are at an increased risk for living in a household not comprised of their two biological or adoptive parents compared to children without ASD in the United States.
Lien vers le texte intégral (Open Access ou abonnement)
26. Froehlich AL, Anderson JS, Bigler ED, Miller JS, Lange NT, Dubray MB, Cooperrider JR, Cariello A, Nielsen JA, Lainhart JE. {{Intact Prototype Formation but Impaired Generalization in Autism}}. {Res Autism Spectr Disord};2012 (Spring);6(2):921-930.
Cognitive processing in autism has been characterized by a difficulty with the abstraction of information across multiple stimuli or situations and subsequent generalization to new stimuli or situations. This apparent difficulty leads to the suggestion that prototype formation, a process of creating a mental summary representation of multiple experienced stimuli that go together in a category, may be impaired in autism. Adults with high functioning autism and a typically developing comparison group matched on age and IQ completed a random dot pattern categorization task. Participants with autism demonstrated intact prototype formation in all four ways it was operationally defined, and this performance was not significantly different from that of control participants. However, participants with autism categorized dot patterns that were more highly distorted from the category prototypes less accurately than did control participants. These findings suggest, at least within the constraints of the random dot pattern task, that although prototype formation may not be impaired in autism, difficulties may exist with the generalization of what has been learned about a category to novel stimuli, particularly as they become less similar to the category’s prototype.
Lien vers le texte intégral (Open Access ou abonnement)
27. Fung LK, Quintin EM, Haas BW, Reiss AL. {{Conceptualizing neurodevelopmental disorders through a mechanistic understanding of fragile X syndrome and Williams syndrome}}. {Curr Opin Neurol};2012 (Apr);25(2):112-124.
PURPOSE OF REVIEW: The overarching goal of this review is to compare and contrast the cognitive-behavioral features of fragile X syndrome (FraX) and Williams syndrome and to review the putative neural and molecular underpinnings of these features. Information is presented in a framework that provides guiding principles for conceptualizing gene-brain-behavior associations in neurodevelopmental disorders. RECENT FINDINGS: Abnormalities, in particular cognitive-behavioral domains with similarities in underlying neurodevelopmental correlates, occur in both FraX and Williams syndrome including aberrant frontostriatal pathways leading to executive function deficits, and magnocellular/dorsal visual stream, superior parietal lobe, inferior parietal lobe, and postcentral gyrus abnormalities contributing to deficits in visuospatial function. Compelling cognitive-behavioral and neurodevelopmental contrasts also exist in these two disorders, for example, aberrant amygdala and fusiform cortex structure and function occurring in the context of contrasting social behavioral phenotypes, and temporal cortical and cerebellar abnormalities potentially underlying differences in language function. Abnormal dendritic development is a shared neurodevelopmental morphologic feature between FraX and Williams syndrome. Commonalities in molecular machinery and processes across FraX and Williams syndrome occur as well – microRNAs involved in translational regulation of major synaptic proteins; scaffolding proteins in excitatory synapses; and proteins involved in axonal development. SUMMARY: Although the genetic variations leading to FraX and Williams syndrome are different, important similarities and contrasts in the phenotype, neurocircuitry, molecular machinery, and cellular processes in these two disorders allow for a unique approach to conceptualizing gene-brain-behavior links occurring in neurodevelopmental disorders.
Lien vers le texte intégral (Open Access ou abonnement)
28. Gai X, Xie HM, Perin JC, Takahashi N, Murphy K, Wenocur AS, D’Arcy M, O’Hara RJ, Goldmuntz E, Grice DE, Shaikh TH, Hakonarson H, Buxbaum JD, Elia J, White PS. {{Rare structural variation of synapse and neurotransmission genes in autism}}. {Mol Psychiatry};2012 (Apr);17(4):402-411.
Autism spectrum disorders (ASDs) comprise a constellation of highly heritable neuropsychiatric disorders. Genome-wide studies of autistic individuals have implicated numerous minor risk alleles but few common variants, suggesting a complex genetic model with many contributing loci. To assess commonality of biological function among rare risk alleles, we compared functional knowledge of genes overlapping inherited structural variants in idiopathic ASD subjects relative to healthy controls. In this study we show that biological processes associated with synapse function and neurotransmission are significantly enriched, with replication, in ASD subjects versus controls. Analysis of phenotypes observed for mouse models of copy-variant genes established significant and replicated enrichment of observable phenotypes consistent with ASD behaviors. Most functional terms retained significance after excluding previously reported ASD loci. These results implicate several new variants that involve synaptic function and glutamatergic signaling processes as important contributors of ASD pathophysiology and suggest a sizable pool of additional potential ASD risk loci.
Lien vers le texte intégral (Open Access ou abonnement)
29. Garcia KL, Yu G, Nicolini C, Michalski B, Garzon DJ, Chiu VS, Tongiorgi E, Szatmari P, Fahnestock M. {{Altered balance of proteolytic isoforms of pro-brain-derived neurotrophic factor in autism}}. {J Neuropathol Exp Neurol};2012 (Apr);71(4):289-297.
ABSTRACT: Defects in synaptic development and plasticity may lead to autism. Brain-derived neurotrophic factor (BDNF) plays a critical role in synaptogenesis and synaptic plasticity. BDNF is synthesized as a precursor, pro-BDNF, which can be processed into either a truncated form or into mature BDNF. Previous studies reported increased BDNF-immunoreactive protein in autism, but the mechanism of this increase has not been investigated. We examined BDNF mRNA by real-time reverse transcription-polymerase chain reaction and BDNF protein by Western blotting and enzyme-linked immunosorbent assay in postmortem fusiform gyrus tissue from 11 patients with autism and 14 controls. BDNF mRNA levels were not different in the autism versus control samples, but total BDNF-like immunoreactive protein, measured by enzyme-linked immunosorbent assay, was greater in autism than in controls. Western blotting revealed greater pro-BDNF and less truncated BDNF in autism compared with controls. These data demonstrate that increased levels of BDNF-immunoreactive protein in autism are not transcriptionally driven. Increased pro-BDNF and reduced truncated BDNF are consistent with defective processing of pro-BDNF to its truncated form. Distortion of the balance among the 3 BDNF isoforms, each of which may exhibit different biological activities, could lead to changes in connectivity and synaptic plasticity and, hence, behavior. Thus, imbalance in proteolytic isoforms is a possible new mechanism for altered synaptic plasticity leading to autism.
Lien vers le texte intégral (Open Access ou abonnement)
30. Ghanizadeh A. {{Malondialdehyde, Bcl-2, Superoxide Dismutase and Glutathione Peroxidase may Mediate the Association of Sonic Hedgehog Protein and Oxidative Stress in Autism}}. {Neurochem Res};2012 (Apr);37(4):899-901.
Sonic hedgehog signaling and brain-derived neurotrophic factor play a neuro-protective role against oxidative stress in autism. Sonic hedgehog also increases Bcl-2 expression and the activities of superoxide dismutase and glutathione peroxidase. The level or activity of Bcl-2, brain-derived neurotrophic factor, and the activities of superoxide dismutase and glutathione peroxidase are decreased in autism. Sonic hedgehog also decreases the production of malondialdehyde that its level is high in autism. Therefore, it is supposed that sonic hedgehog may be associated with oxidative stress in autism through other pathways too.
Lien vers le texte intégral (Open Access ou abonnement)
31. Goldman SE, Richdale AL, Clemons T, Malow BA. {{Parental sleep concerns in autism spectrum disorders: variations from childhood to adolescence}}. {J Autism Dev Disord};2012 (Apr);42(4):531-538.
Sleep problems of adolescents and older children with Autism Spectrum Disorder (ASD) were compared to toddlers and young children in 1,859 children. Sleep was measured with the Children’s Sleep Habits Questionnaire. Total sleep problems were significant across all age groups, however the factors contributing to these problems differed. Adolescents and older children had more problems with delayed sleep onset, shorter sleep duration, and daytime sleepiness; while younger children had more bedtime resistance, sleep anxiety, parasomnias, and night wakings. The results suggest that sleep problems persist through adolescence in ASD with differences in types of problems experienced and emphasize the need for clinicians to address sleep behaviors not only in young children with ASD but throughout the age span.
Lien vers le texte intégral (Open Access ou abonnement)
32. Hall SS, Lightbody AA, McCarthy BE, Parker KJ, Reiss AL. {{Effects of intranasal oxytocin on social anxiety in males with fragile X syndrome}}. {Psychoneuroendocrinology};2012 (Apr);37(4):509-518.
Fragile X syndrome (FXS) is a rare inherited genetic disorder causing severe intellectual disability and autistic-like symptoms. Individuals with FXS, males in particular, often exhibit extreme eye gaze avoidance and hyperarousal when they encounter stressful social situations. We investigated whether oxytocin (OT), a hormone with prosocial and anxiolytic effects, could alleviate symptoms of social anxiety in this population. A randomized double-blind placebo-controlled single-dose trial was performed with intranasal administration of placebo, 24 IU OT and 48 IU OT. Measures of eye gaze frequency, heart rate, respiratory sinus arrhythmia (RSA), heart rate variability (HRV) and salivary cortisol were obtained during a structured social challenge conducted 50 min following OT administration. Ten low-functioning males with FXS (aged 13-28 years) traveled to Stanford for the initial visit: 8 completed the study. Eye gaze frequency improved significantly in response to the 24 IU OT dose and salivary cortisol levels decreased significantly in response to the 48 IU OT dose. There was no effect of OT on heart rate, RSA or HRV although individual plots of the heart rate data suggested that OT increased heart rate in some participants and decreased heart rate in others. These findings suggest that intranasal administration of OT may ameliorate some symptoms of social anxiety in patients with FXS. Further double-blind placebo-controlled studies of OT, conducted in combination with behavioral treatment programs, may be warranted.
Lien vers le texte intégral (Open Access ou abonnement)
33. Hamilton A, Marshal MP, Sucato GS, Murray PJ. {{Rett syndrome and menstruation}}. {J Pediatr Adolesc Gynecol};2012 (Apr);25(2):122-126.
OBJECTIVE: Describe the experience that girls with Rett syndrome have with menstruation including menstrual hygiene, dysmenorrhea, premenstrual syndrome (PMS), and attempts at treatment. DESIGN: Anonymous web-based survey. SETTING: Convenience sample recruited from Rett syndrome LISTSERV in July of 2009. PARTICIPANTS: Mothers of girls with Rett syndrome between the ages of 10-25 who have had at least one menses. MAIN OUTCOME MEASURES: Prevalence, frequency, and severity of dysmenorrhea and PMS; hygiene concerns; and treatments attempts and perceived effectiveness. RESULTS: Dysmenorrhea and PMS are common problems among young women with Rett syndrome. Despite their frequency and severity they do not routinely limit activities. Multiple treatment attempts are common. Hormonal contraception is used mostly for menstrual cycle control with oral contraceptive pills the most commonly used method. CONCLUSIONS: Young women with Rett syndrome have standard symptoms of dysmenorrhea and PMS as well as autism spectrum specific PMS symptoms. Hormonal contraception is commonly used for menstrual management.
Lien vers le texte intégral (Open Access ou abonnement)
34. Hess CR, Landa RJ. {{Predictive and concurrent validity of parent concern about young children at risk for autism}}. {J Autism Dev Disord};2012 (Apr);42(4):575-584.
Parents’ concerns about their children’s development were examined prospectively at 14, 24, and 36 months for 89 younger siblings of a child with autism. Parent reported concern was high at all ages (40-75%) and was higher at 24 and 36 months in children with ASD than non-ASD outcomes (p < .05). Communication concerns were reported most frequently. Parent concern compared to impairment classification based on concurrent standardized tests provided better specificity than sensitivity, and was better for communication than social functioning. Parent communication concern (but not social concern) at 24 months and 36 months predicted ASD versus non-ASD outcome; however, children’s impairment on standardized tests yielded greater predictive value at all ages (p < .001). Close monitoring of this at risk group is warranted.
Lien vers le texte intégral (Open Access ou abonnement)
35. Heulens I, D’Hulst C, Van Dam D, De Deyn PP, Kooy RF. {{Pharmacological treatment of fragile X syndrome with GABAergic drugs in a knockout mouse model}}. {Behav Brain Res};2012 (Apr 1);229(1):244-249.
Molecular and electrophysiological studies have provided evidence for a general downregulation of the GABAergic system in the Fmr1 knockout mouse. GABA(A) receptors are the main inhibitory receptors in the brain and the GABA(A) receptor was proposed as a novel target for treatment of the fragile X syndrome, the most frequent form of intellectual disability. This study examined the functionality of the GABA(A) receptor in rotarod and elevated plus maze tests with fragile X mice treated with GABA(A) receptor agonists, the benzodiazepine diazepam and the neuroactive steroid alphaxalone. In addition, the effect of GABA(A) receptor activation on the audiogenic seizure activity was determined. We proved that the GABA(A) receptor is still sensitive to GABAergic drugs as the sedative effect of diazepam resulted in a decreased latency time on the rotarod and alphaxalone had a clear anxiolytic effect in the elevated plus maze, decreasing the frequency of entries, the total time spent and the path length in the closed arms. We also observed that treatment with ganaxolone could rescue audiogenic seizures in Fmr1 knockout mice. These findings support the hypothesis that the GABA(A) receptor is a potential therapeutic target for fragile X syndrome.
Lien vers le texte intégral (Open Access ou abonnement)
36. Hoeffer CA, Sanchez E, Hagerman RJ, Mu Y, Nguyen DV, Wong H, Whelan AM, Zukin RS, Klann E, Tassone F. {{Altered mTOR signaling and enhanced CYFIP2 expression levels in subjects with fragile X syndrome}}. {Genes Brain Behav};2012 (Apr);11(3):332-341.
Fragile X syndrome (FXS) is the most common form of inherited intellectual disability and autism. The protein (FMRP) encoded by the fragile X mental retardation gene (FMR1), is an RNA-binding protein linked to translational control. Recently, in the Fmr1 knockout mouse model of FXS, dysregulated translation initiation signaling was observed. To investigate whether an altered signaling was also a feature of subjects with FXS compared to typical developing controls, we isolated total RNA and translational control proteins from lymphocytes of subjects from both groups (38 FXS and 14 TD). Although we did not observe any difference in the expression level of messenger RNAs (mRNAs) for translational initiation control proteins isolated from participant with FXS, we found increased phosphorylation of the mammalian target of rapamycin (mTOR) substrate, p70 ribosomal subunit 6 kinase1 (S6K1) and of the mTOR regulator, the serine/threonine protein kinase (Akt), in their protein lysates. In addition, we observed increased phosphorylation of the cap binding protein eukaryotic initiation factor 4E (eIF4E) suggesting that protein synthesis is upregulated in FXS. Similar to the findings in lymphocytes, we observed increased phosphorylation of S6K1 in brain tissue from patients with FXS (n = 4) compared to normal age-matched controls (n = 4). Finally, we detected increased expression of the cytoplasmic FMR1-interacting protein 2 (CYFIP2), a known FMRP interactor. This data verify and extend previous findings using lymphocytes for studies of neuropsychiatric disorders and provide evidence that misregulation of mTOR signaling observed in the FXS mouse model also occurs in human FXS and may provide useful biomarkers for designing targeted treatments in FXS.
Lien vers le texte intégral (Open Access ou abonnement)
37. Hudziak JJ, Novins DK. {{Proposed Criteria for Autism Spectrum Disorder in the DSM-5}}. {J Am Acad Child Adolesc Psychiatry};2012 (Apr);51(4):343.
Lien vers le texte intégral (Open Access ou abonnement)
38. Hutman T, Chela MK, Gillespie-Lynch K, Sigman M. {{Selective visual attention at twelve months: signs of autism in early social interactions}}. {J Autism Dev Disord};2012 (Apr);42(4):487-498.
We examined social attention and attention shifting during (a) a play interaction between 12-month olds and an examiner and (b) after the examiner pretended to hurt herself. We coded the target and duration of infants’ visual fixations and frequency of attention shifts. Siblings of children with autism and controls with no family history of autism were tested at 12 months and screened for ASD at 36 months. Groups did not differ on proportion of attention to social stimuli or attention shifting during the play condition. All groups demonstrated more social attention and attention shifting during the distress condition. Infants later diagnosed with ASD tended to continue looking at a toy during the distress condition despite the salience of social information.
Lien vers le texte intégral (Open Access ou abonnement)
39. James WH. {{A potential explanation of some established major risk factors for autism}}. {Dev Med Child Neurol};2012 (Apr);54(4):301-305.
Baron-Cohen hypothesized that a cause of autism in infants is exposure to high concentrations of intrauterine testosterone concentrations. Some of the subsequent research on this hypothesis has focused on the possibility that the source of this testosterone is the fetus; however, this review shows that if the source is taken to be the mother, then many of the established risk factors for autism could be explained. If that were correct, it would follow that high maternally derived intrauterine androgen concentrations may be a major environmental cause of autism.
Lien vers le texte intégral (Open Access ou abonnement)
40. Just MA, Keller TA, Malave VL, Kana RK, Varma S. {{Autism as a neural systems disorder: A theory of frontal-posterior underconnectivity}}. {Neurosci Biobehav Rev};2012 (Apr);36(4):1292-1313.
The underconnectivity theory of autism attributes the disorder to lower anatomical and functional systems connectivity between frontal and more posterior cortical processing. Here we review evidence for the theory and present a computational model of an executive functioning task (Tower of London) implementing the assumptions of underconnectivity. We make two modifications to a previous computational account of performance and brain activity in typical individuals in the Tower of London task (Newman et al., 2003): (1) the communication bandwidth between frontal and parietal areas was decreased and (2) the posterior centers were endowed with more executive capability (i.e., more autonomy, an adaptation is proposed to arise in response to the lowered frontal-posterior bandwidth). The autism model succeeds in matching the lower frontal-posterior functional connectivity (lower synchronization of activation) seen in fMRI data, as well as providing insight into behavioral response time results. The theory provides a unified account of how a neural dysfunction can produce a neural systems disorder and a psychological disorder with the widespread and diverse symptoms of autism.
Lien vers le texte intégral (Open Access ou abonnement)
41. Kasari C, Rotheram-Fuller E, Locke J, Gulsrud A. {{Making the connection: randomized controlled trial of social skills at school for children with autism spectrum disorders}}. {J Child Psychol Psychiatry};2012 (Apr);53(4):431-439.
BACKGROUND: This study compared two interventions for improving the social skills of high functioning children with autism spectrum disorders in general education classrooms. One intervention involved a peer-mediated approach (PEER) and the other involved a child-assisted approach (CHILD). METHOD: The two interventions were crossed in a 2 x 2 factorial design yielding control, PEER, CHILD, and both PEER and CHILD conditions. Sixty children participated from 56 classrooms in 30 schools. Interventions involved 12 sessions over 6 weeks, with a 3-month follow-up. Outcome measures included self, peer and teacher reports of social skills and independent weekly observations of children on their school playground over the course of the intervention. RESULTS: Significant improvements were found in social network salience, number of friendship nominations, teacher report of social skills in the classroom, and decreased isolation on the playground for children who received PEER interventions. Changes obtained at the end of the treatment persisted to the 3-month follow-up. CONCLUSIONS: These data suggest that significant improvements can be made in peer social connections for children with autism spectrum disorders in general education classrooms with a brief intervention, and that these gains persist over time.
Lien vers le texte intégral (Open Access ou abonnement)
42. Kodak T, Fuchtman R, Paden A. {{A comparison of intraverbal training procedures for children with autism}}. {J Appl Behav Anal};2012 (Spring);45(1):155-160.
We compared the effectiveness of three training procedures, echoic and tact prompting plus error correction and a cues-pause-point (CPP) procedure, for increasing intraverbals in 2 children with autism. We also measured echoic behavior that may have interfered with appropriate question answering. Results indicated that echoic prompting with error correction was most effective and the CPP procedure was least effective for increasing intraverbals and decreasing echoic behavior.
Lien vers le texte intégral (Open Access ou abonnement)
43. Krakowiak P, Goodlin-Jones B, Hertz-Picciotto I, Croen LA, Hansen RL. {{Sleep problems in children with autism spectrum disorders, developmental delays, and typical development: a population-based study}}. {J Sleep Res};2012 (Apr);21(2):231.
Lien vers le texte intégral (Open Access ou abonnement)
44. Ladha S. {{Getting to the bottom of autism spectrum and related disorders: MBD5 as a key contributor}}. {Clin Genet};2012 (Apr);81(4):363-364.
Lien vers le texte intégral (Open Access ou abonnement)
45. Lane A, Harpster K, Heathcock J. {{Motor characteristics of young children referred for possible autism spectrum disorder}}. {Pediatr Phys Ther};2012 (Spring);24(1):21-29.
PURPOSE: To examine motor characteristics of children referred for evaluation for autism spectrum disorder (ASD) using the Bayley Scales of Infant and Toddler Development, Third Edition (BSID-III). METHODS: BSID-III scores were collected through retrospective chart review for 30 children (mean age = 31.57 +/- 6 months) admitted to an outpatient autism evaluation clinic. RESULTS: Children referred to an ASD clinic demonstrated a mean delay of 6 months for gross motor skills and 8 months for fine motor skills. There were no differences in total score or item analysis in group comparisons of motor characteristics in young children who did or did not receive a diagnosis of ASD. CONCLUSIONS: These results suggest that a delay in fine and gross motor skills at an early age is a characteristic of infants referred to an ASD clinic. Furthermore, the BSID-III may not be sensitive enough to distinguish between referred children with and without ASD.
Lien vers le texte intégral (Open Access ou abonnement)
46. Larson MJ, South M, Clayson PE, Clawson A. {{Cognitive control and conflict adaptation in youth with high-functioning autism}}. {J Child Psychol Psychiatry};2012 (Apr);53(4):440-448.
BACKGROUND: Youth diagnosed with autism spectrum disorders (ASD) often show deficits in cognitive control processes, potentially contributing to characteristic difficulties monitoring and regulating behavior. Modification of performance following conflict can be measured by examining conflict adaptation, the adjustment of cognitive resources based on previous-trial conflic
