Pubmed du 12/07/21
1. Åsberg Johnels J, Yngvesson P, Billstedt E, Gillberg C, Halldner L, Råstam M, Gustafsson P, Selinus EN, Lichtenstein P, Hellner C, Anckarsäter H, Lundström S. The relationship between intelligence and global adaptive functioning in young people with or without neurodevelopmental disorders. Psychiatry research. 2021; 303: 114076.
Previous studies have shown an association between IQ and adaptive global functioning, i.e. how well a person is functioning in different domains of life. However, it is unclear to what extent such an association applies in children with neurodevelopmental disorders (NDDs). The study group consisted of 550 population-screened children assessed with the K-SADS, WISC-IV, and the C-GAS. Approximately half of the sample had been diagnosed with one or several NDDs (ADHD, autism, language disorder and tic disorder). A factorial ANOVA with IQ level and the presence of NDD was conducted, with C-GAS score as the dependent variable. Results revealed a significant interaction effect between IQ-group and NDD-status. In the non-NDD group (49% girls), higher IQ scores were clearly linked with better global adaptive functioning. Among children with NDDs (35% girls), however, higher IQ scores were not clearly associated with better functioning. Thus, the association between IQ and adaptive functioning were found to differ depending on the presence of NDD. These results have implications for the interpretation of IQ test results in neurodevelopmental assessments and point towards the importance of providing support based on an assessment of needs and functioning rather than scores from IQ tests.
Lien vers le texte intégral (Open Access ou abonnement)
2. Breider S, Hoekstra PJ, Wardenaar KJ, van den Hoofdakker BJ, Dietrich A, de Bildt A. Early-Life Environmental and Child Factors Associated with the Presence of Disruptive Behaviors in Seven-Year-Old Children with Autistic Traits in the Avon Longitudinal Study of Parents and Children. Journal of autism and developmental disorders. 2021.
We studied the association of early-life environmental and child factors with disruptive behaviors in children with autistic traits around age 7, in the Avon Longitudinal Study of Parents and Children (n = 6,401). Logistic regression with the least absolute shrinkage and selection operator indicated that disruptive behaviors were associated with prenatal smoking, no seafood-consumption during pregnancy, breech presentation at delivery, neonatal feeding problems, low social-economic situation, suboptimal preschool family environment, maternal depression, maternal antisocial behavior, male sex, and difficult child temperament. Compared to controls, male sex, maternal depression, and suboptimal preschool family environment were related to autistic traits without disruptive behaviors. Thus, there may be a difference in early-life factors related to autism spectrum disorder with and without disruptive behaviors.
Lien vers le texte intégral (Open Access ou abonnement)
3. Burdeus-Olavarrieta M, San José-Cáceres A, García-Alcón A, González-Peñas J, Hernández-Jusdado P, Parellada-Redondo M. Characterisation of the clinical phenotype in Phelan-McDermid syndrome. Journal of neurodevelopmental disorders. 2021; 13(1): 26.
BACKGROUND: Phelan-McDermid syndrome (PMS) is a rare genetic disorder compromising the 22q13 terminal region and affecting SHANK3, a gene crucial to the neurobehavioural phenotype and strongly linked to autism (ASD) and intellectual disability (ID). The condition is characterised by global developmental delay, ID, speech impairments, hypotonia and autistic behaviours, although its presentation and symptom severity vary widely. In this study, we provide a thorough description of the behavioural profile in PMS and explore differences related to deletion size and language ability. METHODS: We used standard clinical assessment instruments to measure altered behaviour, adaptive skills and autistic symptomatology in sixty participants with PMS (30 females, median age 8.5 years, SD=7.1). We recorded background information and other clinical manifestations and explored associations with deletion size. We performed descriptive and inferential analyses for group comparison. RESULTS: We found delayed gross and fine motor development, delayed and impaired language (~70% of participants non or minimally verbal), ID of different degrees and adaptive functioning ranging from severe to borderline impairment. Approximately 40% of participants experienced developmental regression, and half of those regained skills. Autistic symptoms were frequent and variable in severity, with a median ADOS-2 CSS score of 6 for every domain. Sensory processing anomalies, hyperactivity, attentional problems and medical comorbidities were commonplace. The degree of language and motor development appeared to be associated with deletion size. CONCLUSIONS: This study adds to previous research on the clinical descriptions of PMS and supports results suggesting wide variability of symptom severity and its association with deletion size. It makes the case for suitable psychotherapeutic and pharmacological approaches, for longitudinal studies to strengthen our understanding of possible clinical courses and for more precise genomic analysis.
Lien vers le texte intégral (Open Access ou abonnement)
4. Chu SY, Kassim S, Gan CH, Fierro V, Chan CMH, Hersh D. « Sometimes I Feel Grateful… »: Experiences of the Adolescent Siblings of Children with Autism Spectrum Disorder in Malaysia. Journal of autism and developmental disorders. 2021: 1-13.
Sibling relationships remain understudied in typically developing adolescents who have siblings with autism spectrum disorder (ASD). This study explored the lived experiences and perceptions of adolescents who have a brother or a sister with a diagnosis of ASD using semi-structured interviews. Using thematic analysis, the participants reported having difficulties communicating with their siblings. Feeling a mixture of emotions was common when interacting with their siblings with ASD and emotional self-regulation was a typical coping strategy utilized by these adolescents. Despite the challenges, having a sibling with ASD led to closer relationships between the siblings. These findings offer insights into these adolescents’ needs and how they may be best supported, informing the practice of speech-language pathology and other health professions.
Lien vers le texte intégral (Open Access ou abonnement)
5. Delanghe JR, Speeckaert MM, Verbeke F, De Buyzere ML. C-Reactive Protein in Neonates and Risk for Autism Spectrum Disorder. Biological psychiatry. 2021; 90(11): e63.
Lien vers le texte intégral (Open Access ou abonnement)
6. Gardner RM, Lee BK, Brynge M, Sjöqvist H, Dalman C, Karlsson H. Reply to: C-Reactive Protein in Neonates and Risk for Autism Spectrum Disorder. Biological psychiatry. 2021; 90(11): e65-e6.
Lien vers le texte intégral (Open Access ou abonnement)
7. Huang Y, Jiao J, Zhang M, Situ M, Yuan D, Lyu P, Li S, Wang Z, Yang Y, Huang Y. [A study on KIF1A gene missense variant analysis and its protein expression and structure profiles of an autism spectrum disorder family trio]. Zhonghua yi xue yi chuan xue za zhi = Zhonghua yixue yichuanxue zazhi = Chinese journal of medical genetics. 2021; 38(7): 620-5.
OBJECTIVE: To analyze the pathogenic variants of the KIF1A gene and its corresponding protein structure in an autism spectrum disorder (ASD) family trio carrying harmful missense variants in the KIF1A gene. METHODS: The peripheral blood DNA of the patient and his parents was extracted and sequenced using whole exome sequencing (WES) technology and verified by Sanger sequencing. Bioinformatics software SIFT, PolyPhen-2, Mutation Taster, and CADD software were used to analyze the harmfulness and conservation of variants. The Human Brain Transcriptome (HBT) database was used to analyze the expression of the KIF1A gene in the brain. PredictProtein and SWISS-MODEL were further used to predict the secondary structure and tertiary structure of KIF1A wild-type protein and variant protein. PyMOL V2.4 was utilized to investigate the change of hydrogen bond connection after protein variant. RESULTS: The WES sequencing revealed a missense variant c.664A>C (p.Asn222His) in the child’s KIF1A gene, and this variant was a de novo variant. The harmfulness prediction results suggest that this variant is harmful. By analyzing expression level of KIF1A gene in the brain. It is found that KIF1A gene widely expressed in various brain regions during embryonic development. By analyzing the variant protein structure, the missense variant of KIF1A will cause many changes in the secondary structure of protein, such as alpha-helix, beta-strand, and protein binding domain. The connection of hydrogen bond and spatial structure will also change, thereby changing the original biological function. CONCLUSION: The KIF1A gene may be a risk gene for ASD.
Lien vers le texte intégral (Open Access ou abonnement)
8. Hugh ML, Ahlers K, Joshi M, Locke J. School-Implemented Interventions for Preschool to High School Students with Autism: An Update on Recent Research. Current psychiatry reports. 2021; 23(9): 54.
PURPOSE OF REVIEW: The purpose of this review is to provide an update on the recent research (2016-2021) that evaluates the effectiveness of school-implemented interventions for students with autism (3-21 years old) from preschool to high school. RECENT FINDINGS: Overall, the recent literature demonstrated that there are EBPs that help students with autism acquire a variety of skills across domains (academic, social communication). Though many educators and peers were able to achieve high-fidelity implementation, there remains variable fidelity of intervention use in some studies. Though there is some evidence that educators and peers can successfully implement interventions, there are additional focal areas that are missing from the literature that are needed in schools (e.g., mental health, vocational). Future research should leverage implementation science approaches to support the use of proven efficacious interventions in schools.
Lien vers le texte intégral (Open Access ou abonnement)
9. Unruh KE, McKinney WS, Bojanek EK, Fleming KK, Sweeney JA, Mosconi MW. Initial action output and feedback-guided motor behaviors in autism spectrum disorder. Molecular autism. 2021; 12(1): 52.
BACKGROUND: Sensorimotor issues are common in autism spectrum disorder (ASD), related to core symptoms, and predictive of worse functional outcomes. Deficits in rapid behaviors supported primarily by feedforward mechanisms, and continuous, feedback-guided motor behaviors each have been reported, but the degrees to which they are distinct or co-segregate within individuals and across development are not well understood. METHODS: We characterized behaviors that varied in their involvement of feedforward control relative to feedback control across skeletomotor (precision grip force) and oculomotor (saccades) control systems in 109 individuals with ASD and 101 age-matched typically developing controls (range: 5-29 years) including 58 individuals with ASD and 57 controls who completed both grip and saccade tests. Grip force was examined across multiple force (15, 45, and 85% MVC) and visual gain levels (low, medium, high). Maximum grip force also was examined. During grip force tests, reaction time, initial force output accuracy, variability, and entropy were examined. For the saccade test, latency, accuracy, and trial-wise variability of latency and accuracy were examined. RESULTS: Relative to controls, individuals with ASD showed similar accuracy of initial grip force but reduced accuracy of saccadic eye movements specific to older ages of our sample. Force variability was greater in ASD relative to controls, but saccade gain variability (across trials) was not different between groups. Force entropy was reduced in ASD, especially at older ages. We also find reduced grip strength in ASD that was more severe in dominant compared to non-dominant hands. LIMITATIONS: Our age-related findings rely on cross-sectional data. Longitudinal studies of sensorimotor behaviors and their associations with ASD symptoms are needed. CONCLUSIONS: We identify reduced accuracy of initial motor output in ASD that was specific to the oculomotor system implicating deficient feedforward control that may be mitigated during slower occurring behaviors executed in the periphery. Individuals with ASD showed increased continuous force variability but similar levels of trial-to-trial saccade accuracy variability suggesting that feedback-guided refinement of motor commands is deficient specifically when adjustments occur rapidly during continuous behavior. We also document reduced lateralization of grip strength in ASD implicating atypical hemispheric specialization.
Lien vers le texte intégral (Open Access ou abonnement)
10. Van Goidsenhoven L. Early interventions for children with an increased likelihood of autism: opportunities and challenges. Developmental medicine and child neurology. 2021; 63(12): 1366.
Lien vers le texte intégral (Open Access ou abonnement)
11. Zakirova-Engstrand R, Roll-Pettersson L, Andersson K, Larsson H, Allodi Westling M, Hirvikoski T. Group Psychoeducational Intervention for Grandparents of Young Children with ASD: An Open Feasibility Study. Journal of autism and developmental disorders. 2021: 1-17.
This initial open feasibility trial reports on feasibility and preliminary effectiveness of the manualized, group-based psychoeducational intervention for grandparents of preschool-aged children with ASD provided by the outpatient habilitation services in Stockholm, Sweden. One hundred and twenty non-custodial grandparents participated in a 6-h intervention program. The study demonstrated good feasibility: 114 (95%) grandparents completed both pre- and post-intervention measures and evaluations and reported high intervention acceptability. The results also indicated that grandparents increased their knowledge about ASD from pre-intervention to post-intervention, gained skills about strategies of supporting their grandchildren and adult children, and appreciated the opportunity to meet and share experiences with other grandparents. Follow-up with a randomized controlled trial design is needed to firmly establish efficacy of this intervention.
Lien vers le texte intégral (Open Access ou abonnement)
12. Zheng S, Chen H, Mo M. [A case of Bainbridge-Ropers syndrome with autism in conjunct with ASXL3 gene variant and its clinical analysis]. Zhonghua yi xue yi chuan xue za zhi = Zhonghua yixue yichuanxue zazhi = Chinese journal of medical genetics. 2021; 38(7): 671-3.
OBJECTIVE: To retrospectively analyze the clinical phenotype and genetic characteristics of a child with severe mental retardation, language and motor development delays and autism. METHODS: High-throughput sequencing was carried out for the patient. Candidate variant was verified by Sanger sequencing and bioinformatics analysis. RESULTS: The child was found to harbor a heterozygous variant of exon 11:c.1421_1422insTGAATTTTCTGAGGAGGCTGAAAGT(p.Leu483*) of the ASXL3 gene. The same variant was found in neither of her parents, suggesting that it has a de novo origin. CONCLUSION: The exon 11:c.1421_1422ins TGAATTTTCTGAGGAGGCTGAAAGT(p.Leu483*) variant of the ASXL3 gene probably underlay the pathogenesis of Bainbridge-Ropers syndrome in this patient. Above finding has enriched the spectrum of ASXL3 gene variants.
